Citrus huanglongbing (HLB) also known as citrus greening is the most destructive disease of citrus worldwide.  Three species of the causal organism have been identified.  These are ‘Candidatus Liberibacter asiaticus’, ‘Ca. L. africanus’ and ‘Ca. L. americanus’ (Bové, 2006). In 2010 a survey of non-citrus plants was conducted on two major citrus producing farms in Clarendon and St Catherine in Jamaica.  This was to determine the possibility of the existence of non-citrus hosts of HLB.  A total of 120 plants belonging to 10 different species and nine families were collected over a period of two months.  The plants collected included weeds as well as non-citrus trees.  None of the plants collected exhibited any symptoms of HLB and at the time of sample collection, no citrus psyllids was observed on the plants.  DNA was extracted from plant samples using the method of Dellaporta et al. (1983) and analysed by PCR using the primer pair OI1 (5` GCGCGTATGCAATACGAGCGGCA3`) and OI2c (5`GCCTCGCGACTTCGCAACCCAT 3`). DNA obtained from a confirmed HLB infected citrus plant from Florida served as the positive control whereas DNA from a citrus plant uninfected by HLB was used as the negative control.

Chemical or enzymic reduction/oxidation of integrin cysteine residues (e.g. by reducing agents and protein disulphide isomerase) may be a mechanism for regulating integrin function. It has also been proposed that unique cysteine residues in the integrin 3 subunit are involved in the regulation of alphaIIbeta3. In the present study, we studied systematically the role of disulphide bonds in 3 on the ligand-binding function of alphaIIbbeta3 by mutating individual cysteine residues of beta3 to serine. We found that the disulphide bonds that are critical for alphaIIbbeta3 regulation are clustered within the EGF (epidermal growth factor) domains. Interestingly, disrupting only a single disulphide bond in the EGF domains was enough to activate alphaIIbeta3 fully. In contrast, only two (of 13) disulphide bonds tested outside the EGF domains activated aIIbbeta3. These results suggest that the disulphide bonds in the EGF domains should be intact to keep alphaIIbbeta3 in an inactive state, and that there is no unique cysteine residue in the EGF domain critical for regulating the receptor. The cysteine residues in the EGF domains are potential targets for chemical or enzymic reduction.

Protein-protein interactions, particularly weak and transient ones, are often mediated by peptide recognition domains, such as Src Homology 2 and 3 (SH2 and SH3) domains, which bind to specific sequence and structural motifs. It is important but challenging to determine the binding specificity of these domains accurately and to predict their physiological interacting partners. In this study, the interactions between 35 peptide ligands (15 binders and 20 non-binders) and the Abl SH3 domain were analyzed using molecular dynamics simulation and the Molecular Mechanics/Poisson-Boltzmann Solvent Area method. The calculated binding free energies correlated well with the rank order of the binding peptides and clearly distinguished binders from non-binders. Free energy component analysis revealed that the van der Waals interactions dictate the binding strength of peptides, whereas the binding specificity is determined by the electrostatic interaction and the polar contribution of desolvation. The binding motif of the Abl SH3 domain was then determined by a virtual mutagenesis method, which mutates the residue at each position of the template peptide relative to all other 19 amino acids and calculates the binding free energy difference between the template and the mutated peptides using the Molecular Mechanics/Poisson-Boltzmann Solvent Area method. A single position mutation free energy profile was thus established and used as a scoring matrix to search peptides recognized by the Abl SH3 domain in the human genome. Our approach successfully picked ten out of 13 experimentally determined binding partners of the Abl SH3 domain among the top 600 candidates from the 218,540 decapeptides with the PXXP motif in the SWISS-PROT database. We expect that this physical-principle based method can be applied to other protein domains as well.