Juvenile idiopathic epilepsy (JIE) is an inherited disease characterized by recurrent seizures during the first year of life in Egyptian Arabian horses. Definitive diagnosis requires an electroencephalogram (EEG) performed by a veterinary specialist. A recent study has suggested that a 19 base-pair deletion, along with a triple-C insertion, in intron five of twelve (∆19InsCCC; chr20:29542397-29542425: GTTCAGGGGACCACATGGCTCTCTATAGA>TATCTTAAGACCC) of the Tripartite Motif-Containing 39-Ribonuclease p/mrp 21kDa Subunit (TRIM39-RPP21) gene is associated with JIE. To confirm this association, a new sample set consisting of nine EEG-phenotyped affected and nine unaffected Egyptian Arabian horses were genotyped using Sanger sequencing. There was no significant genotypic (P = 1.00) or allelic (P = 0.31) association with the ∆19InsCCC variant and JIE status. The previously reported markers in TRIM39-RPPB1 are therefore not associated with JIE in well-phenotyped samples. The ∆19InsCCC variant is a common variant that happens to be positioned in a highly polymorphic region in the Arabian breed.

Background

Glanzmann's thrombasthenia (GT) is a congenital platelet disorder affecting approximately 1:1 000 000 people globally and characterized by impaired platelet aggregation and clot retraction. Autosomal recessive, loss-of-function, variants in ITGA2B or ITGB3 of the αIIbβ3 receptor cause the disease in humans. A cat affected by Glanzmann's and macrothrombocytopenia was presented to the UC Davis VMTH.

Hypothesis/objectives

Severe thrombopathia in this cat has an underlying genetic etiology.

Animals

A single affected patient, 2 age-matched clinically healthy controls, and a geriatric population (n = 20) of normal cats.

Methods

Physical examination and clinical pathology tests were performed on the patient. Flow cytometry and platelet aggregometry analyses for patient phenotyping were performed. Patient and validation cohort gDNA samples were extracted for Sanger sequencing of a previously identified ITGA2B (c.1986delC) variant. Reverse transcriptase PCR was performed on patient and healthy control PRP samples to verify ITGA2B variant consequence.

Results

A novel c.1986_1987insCC autosomal recessive variant in ITGA2B was identified. This variant was absent in a population of 194 unrelated cats spanning 44 different breeds. Complete loss of ITGA2B transcript and protein expression was verified by RT-PCR and flow cytometry, explaining the underlying etiology of GT, and likely macrothrombocytopenia, in this cat.

Conclusions and clinical importance

This study emphasizes the role of precision medicine in cardiovascular disease of cats and identified yet another variant that may be of utility for screening in the feline population. This study provides a small-volume, standardized, successful protocol for adequate platelet RNA isolation and subsequent molecular assessment of gene expression in cats.

We sought to establish a large animal model of inherited hypertrophic cardiomyopathy (HCM) with sufficient disease severity and early penetrance for identification of novel therapeutic strategies. HCM is the most common inherited cardiac disorder affecting 1 in 250-500 people, yet few therapies for its treatment or prevention are available. A research colony of purpose-bred cats carrying the A31P mutation in MYBPC3 was founded using sperm from a single heterozygous male cat. Cardiac function in four generations was assessed by periodic echocardiography and measurement of blood biomarkers. Results showed that HCM penetrance was age-dependent, and that penetrance occurred earlier and was more severe in successive generations, especially in homozygotes. Homozygosity was also associated with progression from preclinical to clinical disease. A31P homozygous cats represent a heritable model of HCM with early disease penetrance and a severe phenotype necessary for interventional studies aimed at altering disease progression. The occurrence of a more severe phenotype in later generations of cats, and the occasional occurrence of HCM in wildtype cats suggests the presence of at least one gene modifier or a second causal variant in this research colony that exacerbates the HCM phenotype when inherited in combination with the A31P mutation.

Hypertrophic cardiomyopathy (HCM) is the most prevalent cardiac disease in cats and lacks efficacious preclinical pharmacologic intervention, prompting investigation of novel therapies. Genetic mutations encoding sarcomeric proteins are implicated in the development of HCM and small molecule myosin inhibitors are an emerging class of therapeutics designed to target the interaction of actin and myosin to alleviate the detrimental effects of inappropriate contractile protein interactions. The purpose of this study was to characterize the pharmacodynamic effects of a single oral dose of the novel cardiac myosin inhibitor aficamten (CK-274) on cardiac function in purpose bred cats with naturally occurring A31P MYBPC3 mutation and a clinical diagnosis of HCM with left ventricular outflow tract obstruction (LVOTO). Five purpose bred cats were treated with aficamten (2 mg/kg) or vehicle and echocardiographic evaluations were performed at 0, 6, 24, and 48 h post-dosing. High dose aficamten (2 mg/kg) reduced left ventricular fractional shortening (LVFS%) by increasing the LV systolic internal dimension (LVIDs) and reduced isovolumic relaxation time (IVRT) compared with baseline without significant adverse effects. The marked reduction in systolic function and reduced IVRT coupled with an increased heart rate in treated cats, suggest a lower dose may be optimal. Further studies to determine optimal dosing of aficamten are indicated.

Objective

Feline hypertrophic cardiomyopathy (HCM) remains a disease with little therapeutic advancement. Rapamycin modulates the mTOR pathway, preventing and reversing cardiac hypertrophy in rodent disease models. Its use in human renal allograft patients is associated with reduced cardiac wall thickness. We sought to evaluate the effects of once-weekly delayed-release (DR) rapamycin over 6 months on echocardiographic, biochemical, and biomarker responses in cats with subclinical, nonobstructive HCM.

Animals

43 client-owned cats with subclinical HCM.

Methods

Cats enrolled in this double-blinded, multicentered, randomized, and placebo-controlled clinical trial were allocated to low- or high-dose DR rapamycin or placebo. Cats underwent physical examination, quality-of-life assessment, blood pressure, hematology, biochemistry, total T4, urinalysis, N-terminal pro-B-type natriuretic peptide, and cardiac troponin I at baseline and days 60, 120, and 180. Fructosamine was analyzed at screening and day 180. Echocardiograms were performed at all time points excluding day 120. Outcome variables were compared using a repeated measures ANCOVA.

Results

No demographic, echocardiographic, or clinicopathologic values were significantly different between study groups at baseline, confirming successful randomization. At day 180, the primary study outcome variable, maximum LV myocardial wall thickness at any location, was significantly lower in the low-dose DR rapamycin group compared to placebo (P = .01). Oral DR rapamycin was well tolerated with no significant differences in adverse events between groups.

Clinical relevance

Results demonstrate that DR rapamycin was well tolerated and may prevent or delay progressive LV hypertrophy in cats with subclinical HCM. Additional studies are warranted to confirm and further characterize these results.

Hypertrophic cardiomyopathy (HCM) is the most prevalent inherited cardiac disease in humans and cats and lacks efficacious pharmacologic interventions in the preclinical phase of disease. LV outflow tract obstruction (LVOTO) is commonly observed in HCM-affected patients and is a primary driver of heart failure symptoms and reduced quality of life. Novel small-molecule cardiac myosin inhibitors target actin-myosin interactions to alleviate overactive protein interactions. A prospective, randomized, controlled cross-over study was performed to evaluate pharmacodynamic effects of two doses (0.3 and 1 mg/kg) of a next-in-class cardiac myosin inhibitor, aficamten (CK-3773274, CK-274), on cardiac function in cats with the A31P MYBPC3 mutation and oHCM. Dose-dependent reductions in LV systolic function, LVOT pressure gradient, and isovolumetric relaxation times compared to baseline were observed. Promising beneficial effects of reduced systolic function warrant further studies of this next-in-class therapeutic to evaluate the benefit of long-term administration in this patient population.

Background

Dual antithrombotic treatment (DAT) with clopidogrel and rivaroxaban sometimes is prescribed to cats with hypertrophic cardiomyopathy at risk of thromboembolism. To date, no studies have evaluated their combined effects on platelet function.

Objectives/hypothesis

Evaluate the safety of DAT in healthy cats and compare, ex vivo, platelet-dependent thrombin generation and agonist-induced platelet activation and aggregation in cats treated with clopidogrel, rivaroxaban, or DAT. We hypothesized that DAT would safely modulate agonist-induced platelet activation and aggregation more effectively than single agent treatment.

Animals

Nine apparently healthy 1-year-old cats selected from a research colony.

Methods

Unblinded, nonrandomized ex vivo cross-over study. All cats received 7 days of rivaroxaban (0.6 ± 0.1 mg/kg PO), clopidogrel (4.7 ± 0.8 mg/kg PO), or DAT with defined washout periods between treatments. Before and after each treatment, adenosine diphosphate (ADP)- and thrombin-induced platelet P-selectin expression was evaluated using flow cytometry to assess platelet activation. Platelet-dependent thrombin generation was measured by fluorescence assay. Platelet aggregation was assessed using whole blood impedance platelet aggregometry.

Results

No cats exhibited adverse effects. Of the 3 treatments, only DAT significantly decreased the number of activated platelets (P = .002), modulated platelet activation in response to thrombin (P = .01), dampened thrombin generation potential (P = .01), and delayed maximum reaction velocity (P = .004) in thrombin generation. Like clopidogrel, DAT inhibited ADP-mediated platelet aggregation. However, rivaroxaban alone resulted in increased aggregation and activation in response to ADP.

Conclusion and clinical importance

Treatment combining clopidogrel and rivaroxaban (DAT) safely decreases platelet activation, platelet response to agonists, and thrombin generation in feline platelets more effectively than monotherapy with either clopidogrel or rivaroxaban.

Hypertrophic cardiomyopathy (HCM) remains the single most common cardiomyopathy in cats, with a staggering prevalence as high as 15%. To date, little to no direct therapeutical intervention for HCM exists for veterinary patients. A previous study aimed to evaluate the effects of delayed-release (DR) rapamycin dosing in a client-owned population of subclinical, non-obstructive, HCM-affected cats and reported that the drug was well tolerated and resulted in beneficial LV remodeling. However, the precise effects of rapamycin in the hypertrophied myocardium remain unknown. Using a feline research colony with naturally occurring hereditary HCM (n = 9), we embarked on the first-ever pilot study to examine the tissue-, urine-, and plasma-level proteomic and tissue-level transcriptomic effects of an intermittent low dose (0.15 mg/kg) and high dose (0.30 mg/kg) of DR oral rapamycin once weekly. Rapamycin remained safe and well tolerated in cats receiving both doses for eight weeks. Following repeated weekly dosing, transcriptomic differences between the low- and high-dose groups support dose-responsive suppressive effects on myocardial hypertrophy and stimulatory effects on autophagy. Differences in the myocardial proteome between treated and control cats suggest potential anti-coagulant/-thrombotic, cellular remodeling, and metabolic effects of the drug. The results of this study closely recapitulate what is observed in the human literature, and the use of rapamycin in the clinical setting as the first therapeutic agent with disease-modifying effects on HCM remains promising. The results of this study establish the need for future validation efforts that investigate the fine-scale relationship between rapamycin treatment and the most compelling gene expression and protein abundance differences reported here.