Plant protoplasts are useful to study both transcriptional regulation and protein subcellular localization in rapid screens. Protoplast transformation can be used in automated platforms for design-build-test cycles of plant promoters, including synthetic promoters. A notable application of protoplasts comes from recent successes in dissecting synthetic promoter activity with poplar mesophyll protoplasts. For this purpose, we constructed plasmids with TurboGFP driven by a synthetic promoter together with TurboRFP constitutively controlled by a 35S promoter, to monitor transformation efficiency, allowing versatile screening of high numbers of cells by monitoring green fluorescent protein expression in transformed protoplasts. Herein, we introduce a protocol for poplar mesophyll protoplast isolation followed by protoplast transformation and image analysis for the selection of valuable synthetic promoters. Graphical overview.

Abiotic stresses can cause significant damage to plants. For sustainable bioenergy crop production, it is critical to generate resistant crops to such stress. Engineering promoters to control the precise expression of stress resistance genes is a very effective way to address the problem. Here we developed stably transformed Populus tremula × Populus alba hybrid poplar (INRA 717-1B4) containing one-of-six synthetic drought stress-inducible promoters (SDs; SD9-1, SD9-2, SD9-3, SD13-1, SD18-1, and SD18-3) identified previously by transient transformation assays. We screened green fluorescent protein (GFP) induction in poplar under osmotic stress conditions. Of six transgenic lines containing synthetic promoter, three lines (SD18-1, 9-2, and 9-3) had significant GFP expression in both salt and osmotic stress treatments. Each synthetic promoter employed heptamerized repeats of specific and short cis-regulatory elements (7 repeats of 7-8 bases). To verify whether the repeats of longer sequences can improve osmotic stress responsiveness, a transgenic poplar containing the synthetic promoter of the heptamerized entire SD9 motif (20 bases, containing all partial SD9 motifs) was generated and measured for GFP induction under osmotic stress. The heptamerized entire SD9 motif did not result in higher GFP expression than the shorter promoters consisting of heptamerized SD9-1, 9-2, and 9-3 (partial SD9) motifs. This result indicates that shorter synthetic promoters (~50 bp) can be used for versatile control of gene expression in transgenic poplar. These synthetic promoters will be useful tools to engineer stress-resilient bioenergy tree crops in the future.

Abiotic stress resistance traits may be especially crucial for sustainable production of bioenergy tree crops. Here, we show the performance of a set of rationally designed osmotic-related and salt stress-inducible synthetic promoters for use in hybrid poplar. De novo motif-detecting algorithms yielded 30 water-deficit (SD) and 34 salt stress (SS) candidate DNA motifs from relevant poplar transcriptomes. We selected three conserved water-deficit stress motifs (SD18, SD13 and SD9) found in 16 co-expressed gene promoters, and we discovered a well-conserved motif for salt response (SS16). We characterized several native poplar stress-inducible promoters to enable comparisons with our synthetic promoters. Fifteen synthetic promoters were designed using various SD and SS subdomains, in which heptameric repeats of five-to-eight subdomain bases were fused to a common core promoter downstream, which, in turn, drove a green fluorescent protein (GFP) gene for reporter assays. These 15 synthetic promoters were screened by transient expression assays in poplar leaf mesophyll protoplasts and agroinfiltrated Nicotiana benthamiana leaves under osmotic stress conditions. Twelve synthetic promoters were induced in transient expression assays with a GFP readout. Of these, five promoters (SD18-1, SD9-2, SS16-1, SS16-2 and SS16-3) endowed higher inducibility under osmotic stress conditions than native promoters. These five synthetic promoters were stably transformed into Arabidopsis thaliana to study inducibility in whole plants. Herein, SD18-1 and SD9-2 were induced by water-deficit stress, whereas SS16-1, SS16-2 and SS16-3 were induced by salt stress. The synthetic biology design pipeline resulted in five synthetic promoters that outperformed endogenous promoters in transgenic plants.

Synthetic promoters may be designed using short cis-regulatory elements (CREs) and core promoter sequences for specific purposes. We identified novel conserved DNA motifs from the promoter sequences of leaf palisade and vascular cell type-specific expressed genes in water-deficit stressed poplar (Populus tremula × Populus alba), collected through low-input RNA-seq analysis using laser capture microdissection. Hexamerized sequences of four conserved 20-base motifs were inserted into each synthetic promoter construct. Two of these synthetic promoters (Syn2 and Syn3) induced GFP in transformed poplar mesophyll protoplasts incubated in 0.5 M mannitol solution. To identify effect of length and sequence from a valuable 20 base motif, 5 and 3 regions from a basic sequence (GTTAACTTCAGGGCCTGTGG) of Syn3 were hexamerized to generate two shorter synthetic promoters, Syn3-10b-1 (5: GTTAACTTCA) and Syn3-10b-2 (3: GGGCCTGTGG). These promoters activities were compared with Syn3 in plants. Syn3 and Syn3-10b-1 were specifically induced in transient agroinfiltrated Nicotiana benthamiana leaves in water cessation for 3 days. In stable transgenic poplar, Syn3 presented as a constitutive promoter but had the highest activity in leaves. Syn3-10b-1 had stronger induction in green tissues under water-deficit stress conditions than mock control. Therefore, a synthetic promoter containing the 5 sequence of Syn3 endowed both tissue-specificity and water-deficit inducibility in transgenic poplar, whereas the 3 sequence did not. Consequently, we have added two new synthetic promoters to the poplar engineering toolkit: Syn3-10b-1, a green tissue-specific and water-deficit stress-induced promoter, and Syn3, a green tissue-preferential constitutive promoter.

The impact of water-deficit (WD) stress on plant metabolism has been predominantly studied at the whole tissue level. However, plant tissues are made of several distinct cell types with unique and differentiated functions, which limits whole tissue 'omics'-based studies to determine only an averaged molecular signature arising from multiple cell types. Advancements in spatial omics technologies provide an opportunity to understand the molecular mechanisms underlying plant responses to WD stress at distinct cell-type levels. Here, we studied the spatiotemporal metabolic responses of two poplar (Populus tremula× P. alba) leaf cell types -palisade and vascular cells- to WD stress using matrix-assisted laser desorption/ionization-mass spectrometry imaging (MALDI-MSI). We identified unique WD stress-mediated metabolic shifts in each leaf cell type when exposed to early and prolonged WD stresses and recovery from stress. During water-limited conditions, flavonoids and phenolic metabolites were exclusively accumulated in leaf palisade cells. However, vascular cells mainly accumulated sugars and fatty acids during stress and recovery conditions, respectively, highlighting the functional divergence of leaf cell types in response to WD stress. By comparing our MALDI-MSI metabolic data with whole leaf tissue gas chromatography-mass spectrometry (GC-MS)-based metabolic profile, we identified only a few metabolites including monosaccharides, hexose phosphates, and palmitic acid that showed a similar accumulation trend at both cell-type and whole leaf tissue levels. Overall, this work highlights the potential of the MSI approach to complement the whole tissue-based metabolomics techniques and provides a novel spatiotemporal understanding of plant metabolic responses to WD stress. This will help engineer specific metabolic pathways at a cellular level in strategic perennial trees like poplars to help withstand future aberrations in environmental conditions and to increase bioenergy sustainability.

The soil region influenced by plant roots, i.e., the rhizosphere, is one of the most complex biological habitats on Earth and significantly impacts global carbon flow and transformation. Understanding the structure and function of the rhizosphere is critically important for maintaining sustainable plant ecosystem services, designing engineered ecosystems for long-term soil carbon storage, and mitigating the effects of climate change. However, studying the biological and ecological processes and interactions in the rhizosphere requires advanced integrated technologies capable of decoding such a complex system at different scales. Here, we review how emerging approaches in sensing, imaging, and computational modeling can advance our understanding of the complex rhizosphere system. Particularly, we provide our perspectives and discuss future directions in developing in situ rhizosphere sensing technologies that could potentially correlate local-scale interactions to ecosystem scale impacts. We first review integrated multimodal imaging techniques for tracking inorganic elements and organic carbon flow at nano- to microscale in the rhizosphere, followed by a discussion on the use of synthetic soil and plant habitats that bridge laboratory-to-field studies on the rhizosphere processes. We then describe applications of genetically encoded biosensors in monitoring nutrient and chemical exchanges in the rhizosphere, and the novel nanotechnology-mediated delivery approaches for introducing biosensors into the root tissues. Next, we review the recent progress and express our vision on field-deployable sensing technologies such as planar optodes for quantifying the distribution of chemical and analyte gradients in the rhizosphere under field conditions. Moreover, we provide perspectives on the challenges of linking complex rhizosphere interactions to ecosystem sensing for detecting biological traits across scales, which arguably requires using the best-available model predictions including the model-experiment and image-based modeling approaches. Experimental platforms relevant to field conditions like SMART (Sensors at Mesoscales with Advanced Remote Telemetry) soils testbed, coupled with ecosystem sensing and predictive models, can be effective tools to explore coupled ecosystem behavior and responses to environmental perturbations. Finally, we envision that with the advent of novel high-resolution imaging capabilities at nano- to macroscale, and remote biosensing technologies, combined with advanced computational models, future studies will lead to detection and upscaling of rhizosphere processes toward ecosystem and global predictions.

Phosphorus is one of the essential nutrients for plant growth, but it may be relatively unavailable to plants because of its chemistry. In soil, the majority of phosphorus is present in the form of a phosphate, usually as metal complexes making it bound to minerals or organic matter. Therefore, inorganic phosphate solubilization is an important process of plant growth promotion by plant associated bacteria and fungi. Non-nodulating plant species have been shown to thrive in low-nutrient environments, in some instances by relying on plant associated microorganisms called endophytes. These microorganisms live within the plant and help supply nutrients for the plant. Despite their potential enormous environmental importance, there are a limited number of studies looking at the direct molecular impact of phosphate solubilizing endophytic bacteria on the host plant. In this work, we studied the impact of two endophyte strains of wild poplar (Populus trichocarpa) that solubilize phosphate. Using a combination of x-ray imaging, spectroscopy methods, and proteomics, we report direct evidence of endophyte-promoted phosphorus uptake in poplar. We found that the solubilized phosphate may react and become insoluble once inside plant tissue, suggesting that endophytes may aid in the re-release of phosphate. Using synchrotron x-ray fluorescence spectromicroscopy, we visualized the nutrient phosphorus inside poplar roots inoculated by the selected endophytes and found the phosphorus in both forms of organic and inorganic phosphates inside the root. Tomography-based root imaging revealed a markedly different root biomass and root architecture for poplar samples inoculated with the phosphate solubilizing bacteria strains. Proteomics characterization on poplar roots coupled with protein network analysis revealed novel proteins and metabolic pathways with possible involvement in endophyte enriched phosphorus uptake. These findings suggest an important role of endophytes for phosphorus acquisition and provide a deeper understanding of the critical symbiotic associations between poplar and the endophytic bacteria.

Histones belong to a family of highly conserved proteins in eukaryotes. They pack DNA into nucleosomes as functional units of chromatin. Post-translational modifications (PTMs) of histones, which are highly dynamic and can be added or removed by enzymes, play critical roles in regulating gene expression. In plants, epigenetic factors, including histone PTMs, are related to their adaptive responses to the environment. Understanding the molecular mechanisms of epigenetic control can bring unprecedented opportunities for innovative bioengineering solutions. Herein, we describe a protocol to isolate the nuclei and purify histones from sorghum leaf tissue. The extracted histones can be analyzed in their intact forms by top-down mass spectrometry (MS) coupled with online reversed-phase (RP) liquid chromatography (LC). Combinations and stoichiometry of multiple PTMs on the same histone proteoform can be readily identified. In addition, histone tail clipping can be detected using the top-down LC-MS workflow, thus, yielding the global PTM profile of core histones (H4, H2A, H2B, H3). We have applied this protocol previously to profile histone PTMs from sorghum leaf tissue collected from a large-scale field study, aimed at identifying epigenetic markers of drought resistance. The protocol could potentially be adapted and optimized for chromatin immunoprecipitation-sequencing (ChIP-seq), or for studying histone PTMs in similar plants.

With growing populations and pressing environmental problems, future economies will be increasingly plant-based. Now is the time to reimagine plant science as a critical component of fundamental science, agriculture, environmental stewardship, energy, technology and healthcare. This effort requires a conceptual and technological framework to identify and map all cell types, and to comprehensively annotate the localization and organization of molecules at cellular and tissue levels. This framework, called the Plant Cell Atlas (PCA), will be critical for understanding and engineering plant development, physiology and environmental responses. A workshop was convened to discuss the purpose and utility of such an initiative, resulting in a roadmap that acknowledges the current knowledge gaps and technical challenges, and underscores how the PCA initiative can help to overcome them.